Display Settings:

Format

Send to:

Choose Destination
Pr012775352

STS probe D5S2471 for LIF receptor alpha (LIFR) and 2 more genes

Synopsis

Field NameValues
NameD5S2471
AliasesHSC0TA082; WI-6958
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLIFR; LIFR; LIFR
UniSTS IDUniSTS:5248

Sequences

>Probe|12775352|PRIMERF Forward PCR primer (outermost) (25b)
AAGTTCTGATTGGCTACTGTAAAGG
>Probe|12775352|PRIMERR Reverse PCR primer (outermost) (22b)
GTTGTGTGTTAAGGGGAAAACC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S2471

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID5248
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678932
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center