Display Settings:

Format

Send to:

Choose Destination
Pr012773142

STS probe Cda13g07 for TIMP metallopeptidase inhibitor 2 (TIMP2) and 3 more genes

Synopsis

Field NameValues
NameCda13g07
AliasesD17S1398E; RH68175
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTIMP2; LOC100580897; TIMP2; TIMP2
UniSTS IDUniSTS:52281

Sequences

>Probe|12773142|PRIMERF Forward PCR primer (outermost) (20b)
GGATGAAAATAGGAGAAGAG
>Probe|12773142|PRIMERR Reverse PCR primer (outermost) (18b)
ATCTTTGAGTAGGTTCGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB417509.09 cr3000Cda13g07
Homo sapienslinkageRutgers Map17 cmCda13g07
Homo sapiensradiation hybridNCBI RH17810 crCda13g07

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID52281
Probe Cross-refcontext specific help for: Probe Cross-refGDB:439608
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center