Display Settings:

Format

Send to:

Choose Destination
Pr012772120

STS probe HUM0C12B05 for cyclin dependent kinase inhibitor 1B (CDKN1B) and 1 more gene

Synopsis

Field NameValues
NameHUM0C12B05
AliasesRH13754; SHGC-2536
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCDKN1B; CDKN1B
UniSTS IDUniSTS:52189

Sequences

>Probe|12772120|PRIMERF Forward PCR primer (outermost) (25b)
GGATAAGTGAAATGGATACTACATC
>Probe|12772120|PRIMERR Reverse PCR primer (outermost) (25b)
AAAAAGAGGGGAAAACCTATTCTAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G312722 cr10000SHGC-2536
Homo sapiensradiation hybridGeneMap99-G312722 cr10000SHGC-2536
Homo sapienslinkageRutgers Map12 cmHUM0C12B05

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID52189
Probe Cross-refcontext specific help for: Probe Cross-refGDB:214348; GDB:223786
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center