Display Settings:

Format

Send to:

Choose Destination
Pr012769153

STS probe UniSTS:519219 for FBJ osteosarcoma oncogene (Fos) and 9 more genes

Synopsis

Field NameValues
NameUniSTS:519219
AliasBP240034A10G4
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFOS; FOS; LOC100412169; LOC100423697; LOC100431197; FOS; FOS; Fos; FOS; Fos
UniSTS IDUniSTS:519219

Sequences

>Probe|12769153|PRIMERF Forward PCR primer (outermost) (20b)
ACCACCTCAACAATGCATGA
>Probe|12769153|PRIMERR Reverse PCR primer (outermost) (20b)
TGGGTCTGCGTCTCTTTTCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmUniSTS:519219

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center