Display Settings:

Format

Send to:

Choose Destination
Pr012766121

STS probe Fzd9 for frizzled class receptor 9 (Fzd9)

Synopsis

Field NameValues
NameFzd9
TypeSTS
Application
Source organism
Source sequence
Target geneFzd9
UniSTS IDUniSTS:516482

Sequences

>Probe|12766121|PRIMERF Forward PCR primer (outermost) (20b)
TCCATGTTCAGGCGTTCATA
>Probe|12766121|PRIMERR Reverse PCR primer (outermost) (20b)
AGTTTCCTCCTGACCGGTTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3798249
UniSTS IDcontext specific help for: UniSTS ID516482
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center