Display Settings:

Format

Send to:

Choose Destination
Pr012763736

STS probe UniSTS:514332 for purinergic receptor P2X, ligand-gated ion channel, 1 (P2RX1) and 3 more genes

Synopsis

Field NameValues
NameUniSTS:514332
Aliasksks291
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100620975; LOC100739675; P2RX1; P2RX1
UniSTS IDUniSTS:514332

Sequences

>Probe|12763736|PRIMERF Forward PCR primer (outermost) (20b)
GGTCCCGTTCTCCACGAAGT
>Probe|12763736|PRIMERR Reverse PCR primer (outermost) (20b)
GAGTTCCACGGGCTGTACGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmUniSTS:514332

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID514332
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center