Display Settings:

Format

Send to:

Choose Destination
Pr012762177

STS probe DXYS28 for short stature homeobox (SHOX)

Synopsis

Field NameValues
NameDXYS28
AliasesRH70230; SY3; sWXD1109
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneSHOX
UniSTS IDUniSTS:51293

Sequences

>Probe|12762177|PRIMERF Forward PCR primer (outermost) (20b)
GGAACTGGCTTTTCATTTCC
>Probe|12762177|PRIMERR Reverse PCR primer (outermost) (20b)
AGGTCACCTGGATGGTCAGT

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXYS28
Homo sapiensphysicalWUSTL-XX0.49 ordinalsWXD1109

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID51293
Probe Cross-refcontext specific help for: Probe Cross-refGDB:187598
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center