Display Settings:

Format

Send to:

Choose Destination
Pr012761988

STS probe RH35849 for distal membrane arm assembly complex 2 (DMAC2) and 3 more genes

Synopsis

Field NameValues
NameRH35849
AliasstSG4769
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesDMAC2; DMAC2; DMAC2; DMAC2
UniSTS IDUniSTS:51276

Sequences

>Probe|12761988|PRIMERF Forward PCR primer (outermost) (21b)
GGAACGTTATTCCCAGAGAGG
>Probe|12761988|PRIMERR Reverse PCR primer (outermost) (19b)
TGTGCTTCTGCCTCTGGAC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419238.01 cr3000stSG4769
Homo sapienslinkageRutgers Map19 cmRH35849
Homo sapiensradiation hybridNCBI RH19419.6 crstSG4769

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID51276
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center