Display Settings:

Format

Send to:

Choose Destination
Pr012757414

STS probe STS-AA007155 for solute carrier family 7 member 1 (SLC7A1) and 1 more gene

Synopsis

Field NameValues
NameSTS-AA007155
AliasesRH75449; sts-AA007155
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLC7A1; SLC7A1
UniSTS IDUniSTS:50864

Sequences

>Probe|12757414|PRIMERF Forward PCR primer (outermost) (25b)
GCTTGTGTGTATTTTTATTTCAGGG
>Probe|12757414|PRIMERR Reverse PCR primer (outermost) (18b)
ACGGGCTTCCTGGTTAGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB41387.41 cr3000sts-AA007155
Homo sapienslinkageRutgers Map13 cmSTS-AA007155
Homo sapiensradiation hybridNCBI RH13212.4 crsts-AA007155

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID50864
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center