Display Settings:

Format

Send to:

Choose Destination
Pr012756687

STS probe Cntf for zinc finger protein 91 pseudogene (Gm7177)

Synopsis

Field NameValues
NameCntf
TypeSTS
Application
Source organism
Source sequence
Target geneGm7177
UniSTS IDUniSTS:507986

Sequences

>Probe|12756687|PRIMERF Forward PCR primer (outermost) (20b)
TGTCGACAAGTAAATCCACA
>Probe|12756687|PRIMERR Reverse PCR primer (outermost) (20b)
GGAGCACCACATTAAATACC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3771710
UniSTS IDcontext specific help for: UniSTS ID507986
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center