Display Settings:

Format

Send to:

Choose Destination
Pr012755688

STS probe UniSTS:507084 for neurogenic differentiation 6 (Neurod6) and 11 more genes

Synopsis

Field NameValues
NameUniSTS:507084
AliasNeurod6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNEUROD6; NEUROD6; NEUROD6; NEUROD6; NEUROD6; Neurod6; Neurod6; Neurod6; NEUROD6; Neurod6; NEUROD6; NEUROD6
UniSTS IDUniSTS:507084

Sequences

>Probe|12755688|PRIMERF Forward PCR primer (outermost) (21b)
ATGTTAACACTACCGTTTGAC
>Probe|12755688|PRIMERR Reverse PCR primer (outermost) (21b)
TTAATTATGAAAAACTGCATT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmUniSTS:507084

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center