Display Settings:

Format

Send to:

Choose Destination
Pr012755580

STS probe Ide

Synopsis

Field NameValues
NameIde
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:506987

Sequences

>Probe|12755580|PRIMERF Forward PCR primer (outermost) (20b)
ATGACTGAAGTGGCCTGGAC
>Probe|12755580|PRIMERR Reverse PCR primer (outermost) (20b)
TCACTTCAGGTTGTGGCAAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center