Display Settings:

Format

Send to:

Choose Destination
Pr012755492

STS probe Fzd1 for frizzled class receptor 1 (Fzd1)

Synopsis

Field NameValues
NameFzd1
AliasHoxa2
TypeSTS
Application
Source organism
Source sequence
Target geneFzd1
UniSTS IDUniSTS:506907

Sequences

>Probe|12755492|PRIMERF Forward PCR primer (outermost) (20b)
AACTTTGTGCCGAAGCACTC
>Probe|12755492|PRIMERR Reverse PCR primer (outermost) (20b)
TGGTAGCAAGGAGGGAGTTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center