Display Settings:

Format

Send to:

Choose Destination
Pr012755362

STS probe Cdca7 for cell division cycle associated 7 pseudogene (D16Ertd727e)

Synopsis

Field NameValues
NameCdca7
TypeSTS
Application
Source organism
Source sequence
Target geneD16Ertd727e
UniSTS IDUniSTS:506790

Sequences

>Probe|12755362|PRIMERF Forward PCR primer (outermost) (20b)
TCTGAGAGCTCTGCAAACGA
>Probe|12755362|PRIMERR Reverse PCR primer (outermost) (20b)
AGCTGCAGTTGCAAATTCCT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3723865
UniSTS IDcontext specific help for: UniSTS ID506790
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center