Display Settings:

Format

Send to:

Choose Destination
Pr012754607

STS probe STS-N22521 for single-pass membrane protein with aspartate rich tail 1 (SMDT1) and 2 more genes

Synopsis

Field NameValues
NameSTS-N22521
AliasesRH38838; sts-N22521
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNDUFA6; SMDT1; SMDT1
UniSTS IDUniSTS:50611

Sequences

>Probe|12754607|PRIMERF Forward PCR primer (outermost) (21b)
GCTTAGTGGACAGCACATCTC
>Probe|12754607|PRIMERR Reverse PCR primer (outermost) (19b)
CTATCAGCAGAAAGGCTCG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB422139.36 cr3000sts-N22521
Homo sapienslinkageRutgers Map22 cmSTS-N22521
Homo sapiensradiation hybridNCBI RH22208.8 crsts-N22521

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID50611
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center