Display Settings:

Format

Send to:

Choose Destination
Pr012753713

STS probe UniSTS:505302 for component of oligomeric golgi complex 6 (COG6) and 9 more genes

Synopsis

Field NameValues
NameUniSTS:505302
AliasCOG6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCOG6; COG6; COG6; COG6; COG6; COG6; COG6; COG6; COG6; COG6
UniSTS IDUniSTS:505302

Sequences

>Probe|12753713|PRIMERF Forward PCR primer (outermost) (20b)
AACTCCCACCACCTGATCTT
>Probe|12753713|PRIMERR Reverse PCR primer (outermost) (20b)
AGGAGAGGATCCAAGACACA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map13 cmUniSTS:505302

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID505302
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center