Display Settings:

Format

Send to:

Choose Destination
Pr012744355

STS probe Shank2

Synopsis

Field NameValues
NameShank2
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:496556

Sequences

>Probe|12744355|PRIMERF Forward PCR primer (outermost) (21b)
TATGATGAGCGTCCCCGGCGG
>Probe|12744355|PRIMERR Reverse PCR primer (outermost) (18b)
ATCATCAGGGTCTAGATT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3641149
UniSTS IDcontext specific help for: UniSTS ID496556
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center