Display Settings:

Format

Send to:

Choose Destination
Pr012743659

STS probe A007A33 for heterogeneous nuclear ribonucleoprotein U (HNRNPU) and 21 more genes

Synopsis

Field NameValues
NameA007A33
AliasRH26197
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHNRNPU; HNRNPU; HNRNPU; HNRNPU; HNRNPU; LOC100447123; HNRNPU; HNRNPU; hnrnpu; caln1; HNRNPU; LOC100623975; HNRNPU; HnrnpuMore
UniSTS IDUniSTS:49593

Sequences

>Probe|12743659|PRIMERF Forward PCR primer (outermost) (20b)
GCTACAAAAATCAATCTCAG
>Probe|12743659|PRIMERR Reverse PCR primer (outermost) (22b)
TACTAAAGAAAACAGTCGACTT

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB414103.31 cr3000A007A33
Homo sapiensradiation hybridNCBI RH14430.8 crA007A33

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5503404
UniSTS IDcontext specific help for: UniSTS ID49593
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center