Display Settings:

Format

Send to:

Choose Destination
Pr012742964

STS probe D13S328 for leucine rich repeats and calponin homology domain containing 1 (LRCH1)

Synopsis

Field NameValues
NameD13S328
AliasesAFM098xd3; RH659; SHGC-3572
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLRCH1
UniSTS IDUniSTS:49050

Sequences

>Probe|12742964|PRIMERF Forward PCR primer (outermost) (20b)
GCCTGAACATCACTTTTTTG
>Probe|12742964|PRIMERR Reverse PCR primer (outermost) (20b)
GGGGGTTTACTTTTGTGAAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3131216 cr10000SHGC-3572
Homo sapiensradiation hybridGeneMap99-G3131212 cr10000AFM098xd3
Homo sapienslinkageRutgers Map13 cmD13S328
Homo sapiensradiation hybridNCBI RH13444.4 crSHGC-3572

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID49050
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center