Display Settings:

Format

Send to:

Choose Destination
Pr012742887

STS probe D3S3931 for transmembrane 4 L six family member 1 (TM4SF1) and 11 more genes

Synopsis

Field NameValues
NameD3S3931
AliasesEST115712; WI-8928
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTM4SF1; LOC100289491; LOC100291511; LOC100292974; TM4SF1; LOC100436111; TM4SF1; TM4SF1; TM4SF1; TM4SF1; TM4SF1; TM4SF1
UniSTS IDUniSTS:48982

Sequences

>Probe|12742887|PRIMERF Forward PCR primer (outermost) (20b)
GCCTCCAAGCACTCCATTTA
>Probe|12742887|PRIMERR Reverse PCR primer (outermost) (19b)
GAACCCCAAGCACATTGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S3931

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID48982
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678039
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center