Display Settings:

Format

Send to:

Choose Destination
Pr031817226

STS probe UniSTS:485772 for histone H4 (LOC457262) and 4 more genes

Synopsis

Field NameValues
NameUniSTS:485772
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100132909; LOC457262; LOC469477; HIST2H4B; LOC730631
UniSTS IDUniSTS:485772

Sequences

>Probe|31817226|PRIMERF Forward PCR primer (outermost) (20b)
TGTCTATCGGGCTCCAGCGG
>Probe|31817226|PRIMERR Reverse PCR primer (outermost) (21b)
GGCCTTTGGGATCGAAACGTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID485772
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center