Display Settings:

Format

Send to:

Choose Destination
Pr031782560

STS probe UniSTS:485673 for DDB1 and CUL4 associated factor 16 (DCAF16) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:485673
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesDCAF16; LOC100584120
UniSTS IDUniSTS:485673

Sequences

>Probe|31782560|PRIMERF Forward PCR primer (outermost) (26b)
GCCAGTGTTAGTCAGTGTTCTGCTGG
>Probe|31782560|PRIMERR Reverse PCR primer (outermost) (25b)
TGACTGAGAAGGCATTAGTGGGCTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmUniSTS:485673

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID485673
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center