Display Settings:

Format

Send to:

Choose Destination
Pr031782538

STS probe UniSTS:485580 for histone cluster 1 H2B family member e (HIST1H2BE) and 3 more genes

Synopsis

Field NameValues
NameUniSTS:485580
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100439336; LOC100593203; LOC696996; HIST1H2BE
UniSTS IDUniSTS:485580

Sequences

>Probe|31782538|PRIMERF Forward PCR primer (outermost) (23b)
CAAATTCCGAGGATCAGGAGATG
>Probe|31782538|PRIMERR Reverse PCR primer (outermost) (23b)
TGGCTCTGAAAAGAGCCTTTGGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmUniSTS:485580

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID485580
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center