Display Settings:

Format

Send to:

Choose Destination
Pr012742130

Homo sapiens STS probe D10S1742

Synopsis

Field NameValues
NameD10S1742
AliasesAFMC005YG5; AFMc005yg5; C005YG5; HSC005YG5; RH31139; SHGC-20607; W6954
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:48298

Sequences

>Probe|12742130|PRIMERF Forward PCR primer (outermost) (18b)
GCCAATGAGATGTGGGCA
>Probe|12742130|PRIMERR Reverse PCR primer (outermost) (22b)
GGATTCAAGATGGAAGTCCCTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 4 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3103103 cr10000SHGC-20607
Homo sapiensradiation hybridGeneMap99-G3103079 cr10000AFMc005yg5
Homo sapienslinkageRutgers Map10 cmD10S1742
Homo sapienslinkageMarshfield1088.41 cmAFMc005yg5
Homo sapienslinkageGenethon1091.6 cmAFMc005yg5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID48298
Probe Cross-refcontext specific help for: Probe Cross-refGDB:612144
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center