Display Settings:

Format

Send to:

Choose Destination
Pr012735509

STS probe Edg6 for sphingosine-1-phosphate receptor 4 (S1pr4) and 1 more gene

Synopsis

Field NameValues
NameEdg6
AliasS1pr4
TypeSTS
Application
Source organism
Source sequence
Target genesS1pr4; S1pr4
UniSTS IDUniSTS:474714

Sequences

>Probe|12735509|PRIMERF Forward PCR primer (outermost) (20b)
CTCCTCATTGTCCTGCACTA
>Probe|12735509|PRIMERR Reverse PCR primer (outermost) (20b)
GATCATCAGCACGGTGTTGA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3606100
UniSTS IDcontext specific help for: UniSTS ID474714
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center