Display Settings:

Format

Send to:

Choose Destination
Pr012734943

STS probe D1S3685E

Synopsis

Field NameValues
NameD1S3685E
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:474204

Sequences

>Probe|12734943|PRIMERF Forward PCR primer (outermost) (20b)
GATCGTGGTGGTAGCCACCA
>Probe|12734943|PRIMERR Reverse PCR primer (outermost) (18b)
CCAGACAGTCAGCAAGAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:3770798
UniSTS IDcontext specific help for: UniSTS ID474204
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center