Display Settings:

Format

Send to:

Choose Destination
Pr012734670

STS probe DXS7479 for lysine acetyltransferase 7 (KAT7) and 7 more genes

Synopsis

Field NameValues
NameDXS7479
AliasesHSC01C082; WI-6160; sWXD2673
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLMCD1; KAT7; KAT7; KAT7; KAT7; LOC648927; KAT7; LOC737348
UniSTS IDUniSTS:47396

Sequences

>Probe|12734670|PRIMERF Forward PCR primer (outermost) (23b)
GCAGAGAACATGCTTTATTGAGG
>Probe|12734670|PRIMERR Reverse PCR primer (outermost) (20b)
GTGGGTTGGGGGAGCTAATT

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensphysicalWUSTL-XX6 ordinalsWXD2673

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:588012
UniSTS IDcontext specific help for: UniSTS ID47396
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center