Display Settings:

Format

Send to:

Choose Destination
Pr012734612

STS probe D8S2279 for AKT serine/threonine kinase 3 (AKT3)

Synopsis

Field NameValues
NameD8S2279
TypeSTS
Application
Source organism
Source sequence
Target geneAKT3
UniSTS IDUniSTS:473907

Sequences

>Probe|12734612|PRIMERF Forward PCR primer (outermost) (20b)
CATTCTCCTGCCTCAGCCTC
>Probe|12734612|PRIMERR Reverse PCR primer (outermost) (24b)
CCCGTCTCTACTAAAAATACAAAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:1323207; RGD:7205858
UniSTS IDcontext specific help for: UniSTS ID473907
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center