Display Settings:

Format

Send to:

Choose Destination
Pr012734611

STS probe D8S2278

Synopsis

Field NameValues
NameD8S2278
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:473906

Sequences

>Probe|12734611|PRIMERF Forward PCR primer (outermost) (20b)
GTTCACACCATTCTCCTGCC
>Probe|12734611|PRIMERR Reverse PCR primer (outermost) (20b)
GAAACCCCGTCTCTACTAAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:1323203; RGD:7205856
UniSTS IDcontext specific help for: UniSTS ID473906
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center