Display Settings:

Format

Send to:

Choose Destination
Pr012733969

STS probe D9S981E for SHC adaptor protein 3 (SHC3) and 4 more genes

Synopsis

Field NameValues
NameD9S981E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSHC3; SHC3; SHC3; SHC3; SHC3
UniSTS IDUniSTS:473328

Sequences

>Probe|12733969|PRIMERF Forward PCR primer (outermost) (20b)
GAAATGCCACTAGGAAGGTG
>Probe|12733969|PRIMERR Reverse PCR primer (outermost) (20b)
CTCATAGCTTTCAGTGCAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmD9S981E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID473328
Probe Cross-refcontext specific help for: Probe Cross-refGDB:438272
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center