Display Settings:

Format

Send to:

Choose Destination
Pr012733588

STS probe D17S864E for eukaryotic translation initiation factor 1 (EIF1) and 11 more genes

Synopsis

Field NameValues
NameD17S864E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEIF1; LOC100335314; LOC100438782; EIF1; LOC100465919; EIF1; LOC100687917; EIF1; EIF1; EIF1; EIF1; EIF1
UniSTS IDUniSTS:472985

Sequences

>Probe|12733588|PRIMERF Forward PCR primer (outermost) (18b)
GGGGTCCGCTTTTAACTT
>Probe|12733588|PRIMERR Reverse PCR primer (outermost) (20b)
GCCTATTGCTTGACCTCTGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S864E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID472985
Probe Cross-refcontext specific help for: Probe Cross-refGDB:193104
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center