Display Settings:

Format

Send to:

Choose Destination
Pr012731900

STS probe HIST2H2AA__3118 for histone cluster 2 H3 family member c (HIST2H3C) and 8 more genes

Synopsis

Field NameValues
NameHIST2H2AA__3118
TypeSTS
Application
Source organism
Source sequence
Target genesHIST2H3C; HIST2H3A; HIST2H2BD; LOC653610; LOC653611; HIST2H2AA4; LOC746430; LOC746444; LOC746468
UniSTS IDUniSTS:471461

Sequences

>Probe|12731900|PRIMERF Forward PCR primer (outermost) (21b)
AGTTTCTCTCGGTGACTACTA
>Probe|12731900|PRIMERR Reverse PCR primer (outermost) (21b)
CAGCATTAACAACTCTTTTAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID471461
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center