Display Settings:

Format

Send to:

Choose Destination
Pr012731372

STS probe DXYS231 for similar to hCG1647242 (LOC100129446) and 1 more gene

Synopsis

Field NameValues
NameDXYS231
AliasesA137XG9; AFMA137XG9; AFMa137xg9; DXYS231X; DXYS231Y; DYS401; HSA137XG9; W5490
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100129446; LOC100134083
UniSTS IDUniSTS:47093

Sequences

>Probe|12731372|PRIMERF Forward PCR primer (outermost) (25b)
GCACATCGGATATACAAGACTACAA
>Probe|12731372|PRIMERR Reverse PCR primer (outermost) (16b)
GGTTGTGGGATGGGTG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXYS231
Homo sapienslinkageMarshfieldX15.66 cmAFMa137xg9
Homo sapienslinkageGenethonX10.7 cmAFMa137xg9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID47093
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603482
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center