Display Settings:

Format

Send to:

Choose Destination
Pr012727905

STS probe UniSTS:467781 for methylmalonyl-CoA mutase (MUT) and 2 more genes

Synopsis

Field NameValues
NameUniSTS:467781
AliasMUT_8484
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMUT; MUT; MUT
UniSTS IDUniSTS:467781

Sequences

>Probe|12727905|PRIMERF Forward PCR primer (outermost) (21b)
GATTATGAATTTCTGTTTGAA
>Probe|12727905|PRIMERR Reverse PCR primer (outermost) (21b)
GAAATATACTGTCAAATTCCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmUniSTS:467781

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID467781
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center