Display Settings:

Format

Send to:

Choose Destination
Pr012726777

STS probe MARC_33719-33720:1054128309:1 for interferon gamma (IFNG)

Synopsis

Field NameValues
NameMARC_33719-33720:1054128309:1
TypeSTS
Application
Source organism
Source sequence
Target geneIFNG
UniSTS IDUniSTS:466764

Sequences

>Probe|12726777|PRIMERF Forward PCR primer (outermost) (27b)
TTGGCTTAAAAACAAAAACACTTATAG
>Probe|12726777|PRIMERR Reverse PCR primer (outermost) (20b)
CAGAGCTGCCATTCAAGAAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID466764
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center