Display Settings:

Format

Send to:

Choose Destination
Pr012723569

STS probe D3S3578 for RNA polymerase II subunit H (POLR2H) and 1 more gene

Synopsis

Field NameValues
NameD3S3578
AliasesAFMa217zh5; HSA217ZH5; RH15534
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPOLR2H; CHRD
UniSTS IDUniSTS:46387

Sequences

>Probe|12723569|PRIMERF Forward PCR primer (outermost) (24b)
GATTGGGTTACAGAGTAGCCACAC
>Probe|12723569|PRIMERR Reverse PCR primer (outermost) (23b)
TCTGAAATGTAGACTGCCCTTTG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S3578
Homo sapienslinkageMarshfield3195.6 cmAFMa217zh5
Homo sapienslinkageGenethon3201.6 cmAFMa217zh5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID46387
Probe Cross-refcontext specific help for: Probe Cross-refGDB:602025; GDB:607074
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center