Display Settings:

Format

Send to:

Choose Destination
Pr012722578

STS probe Cyp17a1

Synopsis

Field NameValues
NameCyp17a1
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:462978

Sequences

>Probe|12722578|PRIMERF Forward PCR primer (outermost) (20b)
GAAGTGCTCGTGAAGAAGGG
>Probe|12722578|PRIMERR Reverse PCR primer (outermost) (20b)
CCCAGGACATCCACAATACC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3053304
UniSTS IDcontext specific help for: UniSTS ID462978
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center