Display Settings:

Format

Send to:

Choose Destination
Pr012721766

STS probe HLA-DQB1_3386 for major histocompatibility complex, class II, DQ beta 1 (PATR-DQB1) and 7 more genes

Synopsis

Field NameValues
NameHLA-DQB1_3386
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100133583; LOC100172120; LOC100294132; LOC100294259; LOC100294318; LOC100457574; PATR-DQB1; HLA-DRB5
UniSTS IDUniSTS:462246

Sequences

>Probe|12721766|PRIMERF Forward PCR primer (outermost) (21b)
AGACTATTTTAACTGGGATTG
>Probe|12721766|PRIMERR Reverse PCR primer (outermost) (21b)
ACTGAGTTGATTTTCTACCTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID462246
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center