Display Settings:

Format

Send to:

Choose Destination
Pr012709314

STS probe D3S2379 for prolyl 3-hydroxylase 2 (P3H2) and 1 more gene

Synopsis

Field NameValues
NameD3S2379
AliasesD3S2472; MH1109; RH5414; RH57999; SX-41_36.SEQ; WI-1189
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesP3H2; P3H2
UniSTS IDUniSTS:45103

Sequences

>Probe|12709314|PRIMERF Forward PCR primer (outermost) (25b)
GAGTGTCTTCTGAATAAACCATACC
>Probe|12709314|PRIMERR Reverse PCR primer (outermost) (22b)
TTCTAGGGACTGTGAACTTTCC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S2379
Homo sapiensradiation hybridNCBI RH31910.2 crWI-1189
Homo sapiensradiation hybridWhitehead-RH3866.5 cr3000WI-1189

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID45103
Probe Cross-refcontext specific help for: Probe Cross-refGDB:355280
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center