Display Settings:

Format

Send to:

Choose Destination
Pr012708380

STS probe D5S2017 for hypothetical LOC462157 (LOC462157)

Synopsis

Field NameValues
NameD5S2017
AliasesAFMB074XG1; AFMb074xg1; B074XG1; HSB074XG1; W6344
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC462157
UniSTS IDUniSTS:45019

Sequences

>Probe|12708380|PRIMERF Forward PCR primer (outermost) (25b)
GAGTCCTCTCACTGATATTTTTGTA
>Probe|12708380|PRIMERR Reverse PCR primer (outermost) (21b)
GTCTATCCTTCCAGATGGTTC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S2017
Homo sapienslinkageMarshfield5145.21 cmAFMb074xg1
Homo sapienslinkageGenethon5144.8 cmAFMb074xg1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID45019
Probe Cross-refcontext specific help for: Probe Cross-refGDB:609924
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center