Display Settings:

Format

Send to:

Choose Destination
Pr012706880

STS probe D16S2567E for protein kinase C beta (PRKCB) and 3 more genes

Synopsis

Field NameValues
NameD16S2567E
AliasesCda0nf07; RH10070; RH85104; RH85176; SHGC-61016; SHGC-61209
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPRKCB; PRKCB; PRKCB; PRKCB
UniSTS IDUniSTS:44884

Sequences

>Probe|12706880|PRIMERF Forward PCR primer (outermost) (20b)
GAGGTGGAGAAGAAATTAAC
>Probe|12706880|PRIMERR Reverse PCR primer (outermost) (18b)
TGGTGATGATGAGGAAAG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB416200.53 cr3000Cda0nf07
Homo sapienslinkageRutgers Map16 cmD16S2567E
Homo sapiensradiation hybridNCBI RH16231.3 crCda0nf07

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID44884
Probe Cross-refcontext specific help for: Probe Cross-refGDB:447126; GDB:450095
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center