Display Settings:

Format

Send to:

Choose Destination
Pr012702007

STS probe STS-N27859 for protein phosphatase, Mg2+/Mn2+ dependent 1F (PPM1F) and 3 more genes

Synopsis

Field NameValues
NameSTS-N27859
AliasesRH38841; sts-N27859
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100286925; PPM1F; PPM1F; PPM1F
UniSTS IDUniSTS:44445

Sequences

>Probe|12702007|PRIMERF Forward PCR primer (outermost) (20b)
GAGCCTCACACGTTGTCTAC
>Probe|12702007|PRIMERR Reverse PCR primer (outermost) (18b)
GTAAATAGCCCCCTGTGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB42237.68 cr3000sts-N27859
Homo sapienslinkageRutgers Map22 cmSTS-N27859
Homo sapiensradiation hybridNCBI RH2249.4 crsts-N27859

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID44445
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center