Display Settings:

Format

Send to:

Choose Destination
Pr012701771

STS probe stSG601429 for interleukin 13 (IL13) and 1 more gene

Synopsis

Field NameValues
NamestSG601429
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIL13; IL13
UniSTS IDUniSTS:444236

Sequences

>Probe|12701771|PRIMERF Forward PCR primer (outermost) (20b)
ACTGTGGCTGCTAGCACTTG
>Probe|12701771|PRIMERR Reverse PCR primer (outermost) (20b)
TACTCGTTGGCTGAGAGCTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmstSG601429

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID444236
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center