Display Settings:

Format

Send to:

Choose Destination
Pr012695242

STS probe SHGC-33780 for ankyrin repeat domain 36C (ANKRD36C)

Synopsis

Field NameValues
NameSHGC-33780
AliasesRH42782; RH42783; RH42784; RH42785; RH42786; RH42787; RH42788; RH42789; RH42790
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneANKRD36C
UniSTS IDUniSTS:43836

Sequences

>Probe|12695242|PRIMERF Forward PCR primer (outermost) (24b)
GAGAACCAATCTTTAAGTTCTGGG
>Probe|12695242|PRIMERR Reverse PCR primer (outermost) (22b)
GGTTGAGATGGATGAATTGACA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G324164 cr10000SHGC-33780
Homo sapiensradiation hybridGeneMap99-G325077 cr10000SHGC-33780
Homo sapiensradiation hybridNCBI RH2507 crSHGC-33780

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID43836
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center