Display Settings:

Format

Send to:

Choose Destination
Pr012694575

STS probe D8S2128 for leptin receptor overlapping transcript-like 1 (LEPROTL1) and 6 more genes

Synopsis

Field NameValues
NameD8S2128
AliasesRH8120; SHGC-16001
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLEPROTL1; LEPROTL1; LEPROTL1; LEPROTL1; LEPROTL1; LEPROTL1; LEPROTL1
UniSTS IDUniSTS:43776

Sequences

>Probe|12694575|PRIMERF Forward PCR primer (outermost) (25b)
GAGAAAATCCTTTTAATCCTTCAGC
>Probe|12694575|PRIMERR Reverse PCR primer (outermost) (18b)
CACGCACACAGGAGATGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G381374 cr10000SHGC-16001
Homo sapiensradiation hybridGeneMap99-G381464 cr10000SHGC-16001
Homo sapienslinkageRutgers Map8 cmD8S2128
Homo sapiensradiation hybridNCBI RH8408.3 crSHGC-16001

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID43776
Probe Cross-refcontext specific help for: Probe Cross-refGDB:739538
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center