Display Settings:

Format

Send to:

Choose Destination
Pr012691623

STS probe SHGC-64018 for isochorismatase domain containing 1 (ISOC1) and 1 more gene

Synopsis

Field NameValues
NameSHGC-64018
AliasRH83923
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesISOC1; ISOC1
UniSTS IDUniSTS:43510

Sequences

>Probe|12691623|PRIMERF Forward PCR primer (outermost) (22b)
GACGTACCAACAATGATTTGGC
>Probe|12691623|PRIMERR Reverse PCR primer (outermost) (20b)
AACATTGTGAGGGGAGTGGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmSHGC-64018

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID43510
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center