Display Settings:

Format

Send to:

Choose Destination
Pr012685624

STS probe D12S1098 for ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B) and 3 more genes

Synopsis

Field NameValues
NameD12S1098
Alias681g7-L
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesANKS1B; ANKS1B; LOC694033; ANKS1B
UniSTS IDUniSTS:42970

Sequences

>Probe|12685624|PRIMERF Forward PCR primer (outermost) (22b)
GACACACAGACCAGACTGTTGG
>Probe|12685624|PRIMERR Reverse PCR primer (outermost) (22b)
AAACCAAAGCAAGAAGTCAAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S1098

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID42970
Probe Cross-refcontext specific help for: Probe Cross-refGDB:384776
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center