Display Settings:

Format

Send to:

Choose Destination
Pr012671339

STS probe D16S2630 for QRWT5810 (UNQ5810) and 2 more genes

Synopsis

Field NameValues
NameD16S2630
AliasesMR7697; RH4136; RH54861; RH77656; SHGC-60917; WI-4563
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesUNQ5810; CLEC19A; LOC730491
UniSTS IDUniSTS:41684

Sequences

>Probe|12671339|PRIMERF Forward PCR primer (outermost) (18b)
GAAATCGCTGCTTGGGAC
>Probe|12671339|PRIMERR Reverse PCR primer (outermost) (24b)
GGAAAGAAGGTAGAAATGATTTGC

References

1.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S2630
Homo sapiensradiation hybridWhitehead-RH1696.3 cr3000WI-4563

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID41684
Probe Cross-refcontext specific help for: Probe Cross-refGDB:458358
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center