Display Settings:

Format

Send to:

Choose Destination
Pr012668245

STS probe REN89256 for filamin A (FLNA) and 1 more gene

Synopsis

Field NameValues
NameREN89256
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFLNA; FLNA
UniSTS IDUniSTS:414054

Sequences

>Probe|12668245|PRIMERF Forward PCR primer (outermost) (20b)
GTTGGGCAGATGCCAATAGC
>Probe|12668245|PRIMERR Reverse PCR primer (outermost) (21b)
CAGCTGAGTTCGTCGTGAACA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmREN89256

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID414054
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center