Display Settings:

Format

Send to:

Choose Destination
Pr012668238

STS probe REN89250 for filamin A (FLNA) and 2 more genes

Synopsis

Field NameValues
NameREN89250
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFLNA; FLNA; FLNA
UniSTS IDUniSTS:414048

Sequences

>Probe|12668238|PRIMERF Forward PCR primer (outermost) (21b)
TGATTATCTGGCCACCTCCAC
>Probe|12668238|PRIMERR Reverse PCR primer (outermost) (20b)
AGATCAAAGCATGGGCTGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmREN89250

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID414048
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center